Loading...
| piRBase Id | piR-mmu-55053 | Accession | DQ723396 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGAACTAACCAGTACCCCAGAGCTCTTGAC | Number of papers | 8 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-138718; PIR232044; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 6 | GSM113695 | 1 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
| 12 | GSM822758 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 16 | GSM822763 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 85 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
| 88 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
| 117 | GSM958038 | 1 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
| 224 | GSM1528806 | 3 | 26588211 | small RNA | 10dpp testes |
| 246 | GSM1318059 | 4 | 25262350 | small RNA | E16.5 whole testes |
| 361 | GSM2500213 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
| 364 | GSM2500216 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
| 365 | GSM2500217 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
| 445 | GSM1096584 | 1 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 2:48700592-48700622:+ | ||
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
|---|---|---|---|
| Title | Characterization of the piRNA complex from rat testes. | ||
| Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
|---|---|---|---|
| Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
| Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||