Loading...
| piRBase Id | piR-mmu-531619 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGCGAGATCAACCTGGACGCATATGACC | Number of papers | 8 |
| Length | 28 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 16 | GSM822763 | 10 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 17 | GSM822764 | 9 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 51 | GSM610966 | 1 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 80 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_2 E16.5 fetal testis |
| 114 | GSM958035 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
| 116 | GSM958037 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 117 | GSM958038 | 1 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
| 129 | GSM466729 | 3 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 131 | GSM466731 | 1 | 20059948 | Mili IP | Tdrd9-/- 14dpp testis |
| 228 | GSM1528810 | 2 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 359 | GSM4635232 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| 449 | GSM1096586 | 1 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 452 | GSM1096604 | 1 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 11:78751451-78751479:- | Ccnq ENSMUST00000059468; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
|---|---|---|---|
| Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
| Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
|---|---|---|---|
| Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
| Authors | Bloom JC, Schimenti JC. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||