Loading...
| piRBase Id | piR-mmu-5178 | Accession | DQ553582 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGGATTAGTGTTGCTTCTTTGATTGGTCT | Number of papers | 12 |
| Length | 29 | Golden piRNA | Y |
| Aliases | piR-20694; PIR14693; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 12 | GSM822758 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 15 | GSM822762 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 17 | GSM822764 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 36 | GSM684621 | 37 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 1 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 57 | GSM319953 | 2 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
| 58 | GSM319954 | 12 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
| 59 | GSM319955 | 4 | 18922463 | small RNA | 16.5 dpc testis |
| 61 | GSM319957 | 24 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 73 | N/A | 3 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
| 75 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
| 79 | N/A | 4 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
| 81 | N/A | 3 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
| 82 | N/A | 2 | 22020280 | Mili IP | wild_type_2 E16.5 fetal testis |
| 83 | N/A | 1 | 22020280 | Miwi2 IP | MiliDAH_1 E16.5 fetal testis |
| 85 | N/A | 10 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
| 86 | N/A | 11 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
| 87 | N/A | 2 | 22020280 | Miwi2 IP | wild_type_1 E16.5 fetal testis |
| 88 | N/A | 7 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
| 116 | GSM958037 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 120 | GSM958041 | 11 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
| 226 | GSM1528808 | 2 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 4 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 3 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 2 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 2 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 237 | GSM433291 | 1 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 240 | GSM433294 | 1 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 246 | GSM1318059 | 1 | 25262350 | small RNA | E16.5 whole testes |
| 247 | GSM1318060 | 2 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
| 348 | GSM3772906 | 22 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 349 | GSM3772907 | 40 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 350 | GSM3772908 | 75 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 351 | GSM3772909 | 47 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 352 | GSM3772910 | 61 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 353 | GSM3772911 | 40 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 442 | GSM1096599 | 124 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 78 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 17 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 63 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 53 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 3 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 3 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 5 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 5:17266703-17266732:- | LINE L1 L1MdF_IV; | |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 1.5076 |
| GSM319954 | 5.5789 |
| GSM319955 | 2.4272 |
| GSM319956 | 0 |
| GSM319957 | 12.3691 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.4684 |
| GSM433289 | 0.4375 |
| GSM433290 | 0 |
| GSM433291 | 0.3557 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0.2347 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
|---|---|---|---|
| Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
| Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||