Loading...
| piRBase Id | piR-mmu-516722 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 1 |
| Sequence | TGAGCTCCAGCTGTAAGGCATATTCTTAAT | Number of papers | 1 |
| Length | 30 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 14:76558041-76558071:- |
| No record. |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| Hmmr | NM_013552 | cleavage | mm9 chr11:40515856-40515876:- | n | 25582079 |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||