Loading...
| piRBase Id | piR-mmu-515487 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGAGATCCAGCTGTAAGGCATTTTTTTC | Number of papers | 7 |
| Length | 28 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 50 | GSM610965 | 17 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
| 51 | GSM610966 | 3 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 61 | GSM319957 | 1 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 116 | GSM958037 | 21 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 117 | GSM958038 | 6 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
| 118 | GSM958039 | 1 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
| 133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
| 224 | GSM1528806 | 7 | 26588211 | small RNA | 10dpp testes |
| 346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
| 441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 13 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 101 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 22 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 47 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 10:47275915-47275943:- | LINE L1 L1MdMus_II; | |
| Location 2 | 11:45400796-45400824:- | ||
| Location 3 | 11:86060215-86060243:- | Brip1 ENSMUST00000044423; | |
| Location 4 | 13:59709476-59709504:+ | Spata31d1a ENSMUST00000224982; | |
| Location 5 | 15:92691904-92691932:+ | Pdzrn4 ENSMUST00000169942; Pdzrn4 ENSMUST00000035399; | |
| Location 6 | 3:23406809-23406837:+ | ||
| Location 7 | 4:12271273-12271301:+ | LTR ERVL-MaLR MTB_Mm; | |
| Location 8 | 6:27526862-27526890:+ | Grm8 ENSMUST00000115323; Grm8 ENSMUST00000115324; Grm8 ENSMUST00000090512; | LTR ERVL-MaLR MTA_Mm; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0.5154 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0.0909 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| Hmmr | NM_013552 | cleavage | mm9 chr11:40515856-40515876:- | n | 25582079 |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||