Loading...

Detail Information of piRNA: piR-mmu-515487

General Information
piRBase Id piR-mmu-515487 Accession N/A
Organism Mouse Number of methods 3
Sequence TGAGATCCAGCTGTAAGGCATTTTTTTC Number of papers 7
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
50 GSM610965 17 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 3 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
116 GSM958037 21 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 6 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
133 GSM475280 1 20022248 Mili IP adult testis
224 GSM1528806 7 26588211 small RNA 10dpp testes
346 GSM475280 1 20022248 Mili-IP testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 13 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 101 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 22 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 47 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
8 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:47275915-47275943:- LINE L1 L1MdMus_II;
Location 2 11:45400796-45400824:-
Location 3 11:86060215-86060243:- Brip1 ENSMUST00000044423;
Location 4 13:59709476-59709504:+ Spata31d1a ENSMUST00000224982;
Location 5 15:92691904-92691932:+ Pdzrn4 ENSMUST00000169942; Pdzrn4 ENSMUST00000035399;
Location 6 3:23406809-23406837:+
Location 7 4:12271273-12271301:+ LTR ERVL-MaLR MTB_Mm;
Location 8 6:27526862-27526890:+ Grm8 ENSMUST00000115323; Grm8 ENSMUST00000115324; Grm8 ENSMUST00000090512; LTR ERVL-MaLR MTA_Mm;
piRNA Expression
The Expression of piRNA: piR-mmu-515487
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Hmmr NM_013552 cleavage mm9 chr11:40515856-40515876:- n 25582079
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.