Loading...
piRBase Id | piR-mmu-515487 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGAGATCCAGCTGTAAGGCATTTTTTTC | Number of papers | 7 |
Length | 28 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
50 | GSM610965 | 17 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
51 | GSM610966 | 3 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
61 | GSM319957 | 1 | 18922463 | Miwi2 IP | 16.5 dpc testis |
116 | GSM958037 | 21 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 6 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
118 | GSM958039 | 1 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
224 | GSM1528806 | 7 | 26588211 | small RNA | 10dpp testes |
346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 13 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 101 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 22 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 47 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 10:47275915-47275943:- | LINE L1 L1MdMus_II; | |
Location 2 | 11:45400796-45400824:- | ||
Location 3 | 11:86060215-86060243:- | Brip1 ENSMUST00000044423; | |
Location 4 | 13:59709476-59709504:+ | Spata31d1a ENSMUST00000224982; | |
Location 5 | 15:92691904-92691932:+ | Pdzrn4 ENSMUST00000169942; Pdzrn4 ENSMUST00000035399; | |
Location 6 | 3:23406809-23406837:+ | ||
Location 7 | 4:12271273-12271301:+ | LTR ERVL-MaLR MTB_Mm; | |
Location 8 | 6:27526862-27526890:+ | Grm8 ENSMUST00000115323; Grm8 ENSMUST00000115324; Grm8 ENSMUST00000090512; | LTR ERVL-MaLR MTA_Mm; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0.5154 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0.0909 |
GSM475281 | 0 |
GSM678422 | 0 |
Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
---|---|---|---|---|---|
Hmmr | NM_013552 | cleavage | mm9 chr11:40515856-40515876:- | n | 25582079 |
No record. |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |