Loading...

Detail Information of piRNA: piR-mmu-5128

General Information
piRBase Id piR-mmu-5128 Accession DQ691186
Organism Mouse Number of methods 5
Sequence TGGATGTGAGATAGATAGGAGAAGGAAGTC Number of papers 14
Length 30 Golden piRNA -
Aliases piR-20649; piR-106508; PIR14648; PIR199834;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 3 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 16587 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 27295 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 19233 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 13417 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 4368 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 4843 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 1744 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 250 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 233 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 17 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 72 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 26 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 138 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 111 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 96 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 55 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 63 20439430 small RNA Mili-/- E16.5 testis
70 GSM509279 2 20439430 small RNA MVH-/- E16.5 testis
71 GSM509280 39 20439430 small RNA MitoPLD-/- 10 dpp testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 284 20534472 Mov10L1 IP wild type adult testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 916 25582079 MIWI CLIP round spermatids
225 GSM1528807 1258 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1958 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2621 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 2572 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 204 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 442 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 483 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 89 26115953 small RNA 25dpp homo tdrd6 KO testes
348 GSM3772906 22 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
352 GSM3772910 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 382 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 2147 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 2461 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1635 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 5852 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1451 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 3406 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 1808 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 4503 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2273 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3637 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:127817748-127817778:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 24.5427
Sample CPM
GSM400968 0
GSM400969 1.6721
GSM433288 47.7746
GSM433289 96.6835
GSM433290 102.5765
GSM433291 31.6597
GSM433292 58.837
GSM433293 42.9635
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 5.2529
The Expression of piRNA: piR-mmu-5128
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Sox6 NM_001025560 deadenylation mm9 chr7:122618988-122619007:- y 24787618
Zkscan17 NM_172941 deadenylation mm9 chr11:59299607-59299626:- y 24787618
Rnf216 NM_080561 deadenylation mm9 chr5:143753037-143753056:- n 24787618
Rrm1 NM_009103 deadenylation mm9 chr7:109618227-109618246:+ n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.