Loading...
| piRBase Id | piR-mmu-5128 | Accession | DQ691186 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 5 |
| Sequence | TGGATGTGAGATAGATAGGAGAAGGAAGTC | Number of papers | 14 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-20649; piR-106508; PIR14648; PIR199834; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 6 | GSM113695 | 3 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
| 11 | GSM822760 | 16587 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 27295 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 19233 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 13417 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 15 | GSM822762 | 4368 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 31 | GSM684624 | 4843 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 32 | GSM684625 | 1744 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 33 | GSM684626 | 250 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 34 | GSM684627 | 233 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 35 | GSM684620 | 17 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 37 | GSM684622 | 72 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 38 | GSM684623 | 26 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 138 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 111 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 66 | GSM509275 | 96 | 20439430 | small RNA | MitoPLD+/+ E16.5 testis |
| 67 | GSM509276 | 55 | 20439430 | small RNA | MitoPLD-/- E16.5 testis |
| 68 | GSM509277 | 63 | 20439430 | small RNA | Mili-/- E16.5 testis |
| 70 | GSM509279 | 2 | 20439430 | small RNA | MVH-/- E16.5 testis |
| 71 | GSM509280 | 39 | 20439430 | small RNA | MitoPLD-/- 10 dpp testis |
| 119 | GSM958040 | 1 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
| 121 | GSM545783 | 284 | 20534472 | Mov10L1 IP | wild type adult testis |
| 134 | N/A | N/A | 24787618 | Miwi CLIP | elongating spermatids |
| 217 | GSM1653802 | 916 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 1258 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 1958 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 2621 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 2572 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 204 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 442 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 483 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 89 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 348 | GSM3772906 | 22 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 352 | GSM3772910 | 2 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 441 | GSM1096582 | 382 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 2147 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 2461 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 1635 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 5852 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 1451 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 3406 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 1808 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 4503 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 2273 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 3637 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 6:127817748-127817778:+ |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 24.5427 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 1.6721 |
| GSM433288 | 47.7746 |
| GSM433289 | 96.6835 |
| GSM433290 | 102.5765 |
| GSM433291 | 31.6597 |
| GSM433292 | 58.837 |
| GSM433293 | 42.9635 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 5.2529 |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| Sox6 | NM_001025560 | deadenylation | mm9 chr7:122618988-122619007:- | y | 24787618 |
| Zkscan17 | NM_172941 | deadenylation | mm9 chr11:59299607-59299626:- | y | 24787618 |
| Rnf216 | NM_080561 | deadenylation | mm9 chr5:143753037-143753056:- | n | 24787618 |
| Rrm1 | NM_009103 | deadenylation | mm9 chr7:109618227-109618246:+ | n | 24787618 |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
|---|---|---|---|
| Title | Characterization of the piRNA complex from rat testes. | ||
| Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 24787618 | Journal | Cell Res. 2014 Jun;24(6):680-700. |
|---|---|---|---|
| Title | Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis. | ||
| Authors | VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
|---|---|---|---|
| Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
| Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||