Loading...

Detail Information of piRNA: piR-mmu-50962

General Information
piRBase Id piR-mmu-50962 Accession DQ719597
Organism Mouse Number of methods 4
Sequence GGTCGATGATGAGAGCTTTGTTCTGAGC Number of papers 15
Length 28 Golden piRNA -
Aliases piR-134919; PIR228245;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 66 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 9 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 5 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 107 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 123 18922463 small RNA 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 103 18922463 small RNA 4-6 week ovary
73 N/A 46 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 66 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 8 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 79 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 17 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 20 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 37 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 12 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 57 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 155 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 49 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 56 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 211 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 55 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 32 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 70 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 3 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 2 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
122 N/A 2459 21515829 small RNA hippocampus
126 GSM466728 3 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 2 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 3 20059948 Mili IP Tdrd9-/- 14dpp testis
132 GSM475279 230 20022248 Miwi IP adult testis
133 GSM475280 94 20022248 Mili IP adult testis
224 GSM1528806 12 26588211 small RNA 10dpp testes
225 GSM1528807 727 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1024 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 382 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1256 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 40 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 59 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 30 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 10 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 65 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 78 25262350 small RNA E16.5 whole testes
247 GSM1318060 52 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 230 20022248 Miwi-IP testis 
346 GSM475280 94 20022248 Mili-IP testis 
347 GSM475281 947 20022248 small RNA testis 
348 GSM3772906 1708 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 3536 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 6222 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 4983 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 3883 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 3621 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 644 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 1488 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 5291 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 223 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 14482 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 2027 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 283 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 6 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 642 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 9 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1363 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 17 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:130749674-130749702:+ Pum1 ENSMUST00000030315; Pum1 ENSMUST00000105992; Pum1 ENSMUST00000105991; Pum1 ENSMUST00000097864; Pum1 ENSMUST00000097862; Snord85 ENSMUST00000083262;
Location 2 CHR_MG4266_PATCH:130701560-130701588:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 80.5628
GSM261959 3.7548
GSM319953 0
GSM319954 0
GSM319955 74.6378
GSM319956 0
GSM319957 0.5154
GSM319958 165.969
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.3107
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 9.3676
GSM433289 12.9057
GSM433290 6.3712
GSM433291 3.5573
GSM433292 8.0232
GSM433293 4.2538
GSM433294 15.2523
GSM433295 26.3999
GSM475279 22.0921
GSM475280 8.5465
GSM475281 88.8406
GSM678422 431.1604
The Expression of piRNA: piR-mmu-50962
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.