Loading...

Detail Information of piRNA: piR-mmu-50504

General Information
piRBase Id piR-mmu-50504 Accession DQ719151
Organism Mouse Number of methods 4
Sequence TTAACTCAAACAAGTCAATGGCCTTTCTCTA Number of papers 10
Length 31 Golden piRNA -
Aliases piR-134473; PIR227799;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
12 GSM822758 6 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
66 GSM509275 13 20439430 small RNA MitoPLD+/+ E16.5 testis
69 GSM509278 2 20439430 small RNA Miwi2-/- E16.5 testis
116 GSM958037 6 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 54 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 20 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 2 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
358 GSM4635231 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
361 GSM2500213 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
362 GSM2500214 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
364 GSM2500216 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 3 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 32 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
9048 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:76778425-76778456:+ Gm10649 ENSMUST00000143324; Gm10649 ENSMUST00000136538;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0
GSM433290 0.2124
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-50504
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.