Loading...

Detail Information of piRNA: piR-mmu-503

General Information
piRBase Id piR-mmu-503 Accession DQ549258
Organism Mouse Number of methods 4
Sequence TGCAGCCAAGCCTGTGCGATGAGGTC Number of papers 7
Length 26 Golden piRNA Y
Aliases piR-17370; PIR10369;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
37 GSM684622 49 22842725 Mili CLIP C57BL/6 adult testis
63 GSM319959 1 18922463 small RNA 2 dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 44 20022248 Mili IP adult testis
225 GSM1528807 39 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 48 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 51 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 71 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 27 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 66 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 44 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 8 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 44 20022248 Mili-IP testis 
347 GSM475281 5 20022248 small RNA testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
446 GSM1096601 7 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 7 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 12 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 5 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113324429-113324455:- Gm43353 ENSMUST00000199224;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0.683
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 6.3231
GSM433289 14.4369
GSM433290 9.3444
GSM433291 2.8458
GSM433292 12.6427
GSM433293 6.8061
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 4.0005
GSM475281 0.4691
GSM678422 0
The Expression of piRNA: piR-mmu-503
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.