Loading...

Detail Information of piRNA: piR-mmu-496

General Information
piRBase Id piR-mmu-496 Accession DQ549251
Organism Mouse Number of methods 4
Sequence TGCAGCAGGGCTGGGACTAGGATGGA Number of papers 12
Length 26 Golden piRNA Y
Aliases piR-17363; PIR10362;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 21 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 3 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 953 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 396 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 10 20439430 small RNA Mili-/- E16.5 testis
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
77 N/A 1 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
121 GSM545783 610 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 5 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 6 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 8 20022248 Miwi IP adult testis
133 GSM475280 40 20022248 Mili IP adult testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
225 GSM1528807 143 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 140 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 266 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 330 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 56 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 156 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 131 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 11 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 8 20022248 Miwi-IP testis 
346 GSM475280 40 20022248 Mili-IP testis 
347 GSM475281 9 20022248 small RNA testis 
441 GSM1096582 98 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 625 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 212 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 324 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 602 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 43 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 40 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 129 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 158 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 140 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 73 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113349228-113349254:+
piRNA Expression
Sample CPM
GSM400968 17.1946
GSM400969 0
GSM433288 13.1146
GSM433289 34.1236
GSM433290 27.821
GSM433291 3.913
GSM433292 18.4777
GSM433293 15.7391
GSM433294 0
GSM433295 0
GSM475279 0.7684
GSM475280 3.6368
GSM475281 0.8443
GSM678422 0.1061
The Expression of piRNA: piR-mmu-496
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Eif4g1 NM_145941 deadenylation mm9 chr16:20692876-20692895:+ n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.