Loading...
| piRBase Id | piR-mmu-496 | Accession | DQ549251 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGCAGCAGGGCTGGGACTAGGATGGA | Number of papers | 12 |
| Length | 26 | Golden piRNA | Y |
| Aliases | piR-17363; PIR10362; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 21 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 17 | GSM822764 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 50 | GSM610965 | 3 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
| 51 | GSM610966 | 953 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 396 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 66 | GSM509275 | 1 | 20439430 | small RNA | MitoPLD+/+ E16.5 testis |
| 68 | GSM509277 | 10 | 20439430 | small RNA | Mili-/- E16.5 testis |
| 73 | N/A | 1 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
| 77 | N/A | 1 | 22020280 | Mili IP | Miwi2+/-_1 E16.5 fetal testis |
| 121 | GSM545783 | 610 | 20534472 | Mov10L1 IP | wild type adult testis |
| 126 | GSM466728 | 5 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 129 | GSM466729 | 6 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 132 | GSM475279 | 8 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 40 | 20022248 | Mili IP | adult testis |
| 134 | N/A | N/A | 24787618 | Miwi CLIP | elongating spermatids |
| 225 | GSM1528807 | 143 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 140 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 266 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 330 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 56 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 156 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 131 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 11 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 345 | GSM475279 | 8 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 40 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 9 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 98 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 625 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 212 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 324 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 602 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 43 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 40 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 129 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 158 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 140 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 73 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 5:113349228-113349254:+ |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 225.8552 |
| Sample | CPM |
|---|---|
| GSM400968 | 17.1946 |
| GSM400969 | 0 |
| GSM433288 | 13.1146 |
| GSM433289 | 34.1236 |
| GSM433290 | 27.821 |
| GSM433291 | 3.913 |
| GSM433292 | 18.4777 |
| GSM433293 | 15.7391 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0.7684 |
| GSM475280 | 3.6368 |
| GSM475281 | 0.8443 |
| GSM678422 | 0.1061 |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| Eif4g1 | NM_145941 | deadenylation | mm9 chr16:20692876-20692895:+ | n | 24787618 |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
|---|---|---|---|
| Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
| Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 24787618 | Journal | Cell Res. 2014 Jun;24(6):680-700. |
|---|---|---|---|
| Title | Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis. | ||
| Authors | VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||