Loading...

Detail Information of piRNA: piR-mmu-49

General Information
piRBase Id piR-mmu-49 Accession DQ548932
Organism Mouse Number of methods 4
Sequence TGCAAGTGTTCGGGTTGCTGACTGC Number of papers 12
Length 25 Golden piRNA Y
Aliases piR-17044; PIR10043;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
31 GSM684624 6 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 27 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 25 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 2 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 14 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 2 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
73 N/A 10 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 8 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 9 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 5 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 2 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 5 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 2 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 10 22020280 Mili IP wild_type_2 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 17 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 7 20022248 Miwi IP adult testis
133 GSM475280 109 20022248 Mili IP adult testis
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 14 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 34 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 37 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 58 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 13 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 36 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 21 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 5 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 7 20022248 Miwi-IP testis 
346 GSM475280 109 20022248 Mili-IP testis 
347 GSM475281 12 20022248 small RNA testis 
441 GSM1096582 64 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 87 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 134 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 143 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 522 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 31 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 169 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 161 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 553 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 152 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 393 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:85988729-85988754:- Gm19265 ENSMUST00000201818;
piRNA Expression
Sample CPM
GSM400968 1.1724
GSM400969 0
GSM433288 3.0445
GSM433289 7.8747
GSM433290 4.4598
GSM433291 1.7786
GSM433292 5.3488
GSM433293 5.53
GSM433294 0
GSM433295 0
GSM475279 0.6724
GSM475280 9.9103
GSM475281 1.1258
GSM678422 0.1592
The Expression of piRNA: piR-mmu-49
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.