Loading...

Detail Information of piRNA: piR-mmu-4881

General Information
piRBase Id piR-mmu-4881 Accession DQ553298
Organism Mouse Number of methods 3
Sequence TGGAGATTCAGAGCAAGCCGCACCTCTGG Number of papers 9
Length 29 Golden piRNA Y
Aliases piR-20410; PIR14409;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 4 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
61 GSM319957 5 18922463 Miwi2 IP 16.5 dpc testis
69 GSM509278 2 20439430 small RNA Miwi2-/- E16.5 testis
132 GSM475279 26 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 6 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 13 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 12 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 6 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 4 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 12 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 5 26115953 small RNA 25dpp hetero tdrd6 KO testes
240 GSM433294 15 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
345 GSM475279 26 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 9 20022248 small RNA testis 
361 GSM2500213 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
441 GSM1096582 5 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 516 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 76 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 99 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 168 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 359 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 5 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 22 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 8 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 20 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
424 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:73856018-73856047:- Pcdh15 ENSMUST00000123398; Pcdh15 ENSMUST00000193174; Pcdh15 ENSMUST00000064562; Pcdh15 ENSMUST00000191854; Pcdh15 ENSMUST00000149977; Pcdh15 ENSMUST00000177107; Pcdh15 ENSMUST00000146682; Pcdh15 ENSMUST00000155701; Pcdh15 ENSMUST00000152819; Pcdh15 ENSMUST00000152655; Pcdh15 ENSMUST00000151116; Pcdh15 ENSMUST00000144302; Pcdh15 ENSMUST00000131724; Pcdh15 ENSMUST00000125517; Pcdh15 ENSMUST00000124046; Pcdh15 ENSMUST00000193361; Pcdh15 ENSMUST00000147189; Pcdh15 ENSMUST00000136096; Pcdh15 ENSMUST00000131321; Pcdh15 ENSMUST00000129404; Pcdh15 ENSMUST00000126920; Pcdh15 ENSMUST00000125055; Pcdh15 ENSMUST00000105429; Pcdh15 ENSMUST00000105424; Pcdh15 ENSMUST00000092420; Pcdh15 ENSMUST00000105426; Pcdh15 ENSMUST00000177420; Pcdh15 ENSMUST00000134009; Pcdh15 ENSMUST00000125006; LINE L1 Lx7;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0.8221
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0.6068
GSM319956 0
GSM319957 2.5769
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.9368
GSM433289 2.6249
GSM433290 1.0619
GSM433291 0
GSM433292 0.7294
GSM433293 0
GSM433294 3.5198
GSM433295 0
GSM475279 2.4974
GSM475280 0.0909
GSM475281 0.8443
GSM678422 0
The Expression of piRNA: piR-mmu-4881
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.