Loading...
| piRBase Id | piR-mmu-4881 | Accession | DQ553298 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGGAGATTCAGAGCAAGCCGCACCTCTGG | Number of papers | 9 |
| Length | 29 | Golden piRNA | Y |
| Aliases | piR-20410; PIR14409; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 4 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 57 | GSM319953 | 1 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
| 59 | GSM319955 | 1 | 18922463 | small RNA | 16.5 dpc testis |
| 61 | GSM319957 | 5 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 69 | GSM509278 | 2 | 20439430 | small RNA | Miwi2-/- E16.5 testis |
| 132 | GSM475279 | 26 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
| 225 | GSM1528807 | 6 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 13 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 12 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 6 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 4 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 12 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 5 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 240 | GSM433294 | 15 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 345 | GSM475279 | 26 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 9 | 20022248 | small RNA | testis |
| 361 | GSM2500213 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
| 441 | GSM1096582 | 5 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 442 | GSM1096599 | 516 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 76 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 99 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 168 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 359 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 5 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 5 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 22 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 8 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 20 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 10:73856018-73856047:- | Pcdh15 ENSMUST00000123398; Pcdh15 ENSMUST00000193174; Pcdh15 ENSMUST00000064562; Pcdh15 ENSMUST00000191854; Pcdh15 ENSMUST00000149977; Pcdh15 ENSMUST00000177107; Pcdh15 ENSMUST00000146682; Pcdh15 ENSMUST00000155701; Pcdh15 ENSMUST00000152819; Pcdh15 ENSMUST00000152655; Pcdh15 ENSMUST00000151116; Pcdh15 ENSMUST00000144302; Pcdh15 ENSMUST00000131724; Pcdh15 ENSMUST00000125517; Pcdh15 ENSMUST00000124046; Pcdh15 ENSMUST00000193361; Pcdh15 ENSMUST00000147189; Pcdh15 ENSMUST00000136096; Pcdh15 ENSMUST00000131321; Pcdh15 ENSMUST00000129404; Pcdh15 ENSMUST00000126920; Pcdh15 ENSMUST00000125055; Pcdh15 ENSMUST00000105429; Pcdh15 ENSMUST00000105424; Pcdh15 ENSMUST00000092420; Pcdh15 ENSMUST00000105426; Pcdh15 ENSMUST00000177420; Pcdh15 ENSMUST00000134009; Pcdh15 ENSMUST00000125006; | LINE L1 Lx7; |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0.8221 |
| GSM261959 | 0 |
| GSM319953 | 0.7538 |
| GSM319954 | 0 |
| GSM319955 | 0.6068 |
| GSM319956 | 0 |
| GSM319957 | 2.5769 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.9368 |
| GSM433289 | 2.6249 |
| GSM433290 | 1.0619 |
| GSM433291 | 0 |
| GSM433292 | 0.7294 |
| GSM433293 | 0 |
| GSM433294 | 3.5198 |
| GSM433295 | 0 |
| GSM475279 | 2.4974 |
| GSM475280 | 0.0909 |
| GSM475281 | 0.8443 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
|---|---|---|---|
| Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
| Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||