Loading...

Detail Information of piRNA: piR-mmu-4677

General Information
piRBase Id piR-mmu-4677 Accession DQ694694
Organism Mouse Number of methods 5
Sequence TGGACAACCGACTCCATTGCTTAGCGTGG Number of papers 14
Length 29 Golden piRNA Y
Aliases piR-20195; piR-110016; PIR14194; PIR203342;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 10 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 161 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 113 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 152 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 101 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 10 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 26 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 64 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 24 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 93 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 41 22842725 Miwi CLIP C57BL/6 adult testis
38 GSM684623 5 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 3 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 4 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 4 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 186 20022248 Miwi IP adult testis
133 GSM475280 23 20022248 Mili IP adult testis
217 GSM1653802 460 25582079 MIWI CLIP round spermatids
225 GSM1528807 1089 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 617 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 887 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1273 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 20 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 67 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 147 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 54 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 186 20022248 Miwi-IP testis 
346 GSM475280 23 20022248 Mili-IP testis 
347 GSM475281 115 20022248 small RNA testis 
348 GSM3772906 65 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 63 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 60 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 61 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 157 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 936 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 190 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 598 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 536 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1322 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 993 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 2293 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:74640064-74640093:+
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.6838
GSM433289 14.6556
GSM433290 31.2189
GSM433291 19.2093
GSM433292 42.0612
GSM433293 32.7543
GSM433294 0
GSM433295 0
GSM475279 17.8658
GSM475280 2.0912
GSM475281 10.7885
GSM678422 1.0081
The Expression of piRNA: piR-mmu-4677
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.