Loading...

Detail Information of piRNA: piR-mmu-46685

General Information
piRBase Id piR-mmu-46685 Accession DQ715526
Organism Mouse Number of methods 4
Sequence CACCAAGATGAGTGGTGCAAATCTGATC Number of papers 13
Length 28 Golden piRNA -
Aliases piR-130848; PIR224174;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
50 GSM610965 439 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 19 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 55 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 38 18922463 small RNA 16.5 dpc testis
61 GSM319957 3 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 3452 18922463 small RNA 4-6 week ovary
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
120 GSM958041 2 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
122 N/A 207 21515829 small RNA hippocampus
132 GSM475279 47 20022248 Miwi IP adult testis
133 GSM475280 10 20022248 Mili IP adult testis
224 GSM1528806 16 26588211 small RNA 10dpp testes
225 GSM1528807 949 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1186 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 632 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 889 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 19 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 21 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 17 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 6 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 11 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 252 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 80 25262350 small RNA E16.5 whole testes
247 GSM1318060 69 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 47 20022248 Miwi-IP testis 
346 GSM475280 10 20022248 Mili-IP testis 
347 GSM475281 226 20022248 small RNA testis 
348 GSM3772906 285 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 393 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 893 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 719 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 529 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 440 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 71 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 477 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 7 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 840 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 136 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 28 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 51 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 55 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:144265980-144266008:- Snx5 ENSMUST00000110030; Snx5 ENSMUST00000028909; Snord17 ENSMUST00000104526;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 41.1034
GSM261959 3.7548
GSM319953 0
GSM319954 0
GSM319955 23.0588
GSM319956 0
GSM319957 1.5461
GSM319958 5562.3769
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.3107
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.4496
GSM433289 4.5936
GSM433290 3.6104
GSM433291 2.1344
GSM433292 2.6744
GSM433293 5.1046
GSM433294 59.1319
GSM433295 24.0215
GSM475279 4.5145
GSM475280 0.9092
GSM475281 21.2017
GSM678422 5.7835
The Expression of piRNA: piR-mmu-46685
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.