Loading...

Detail Information of piRNA: piR-mmu-4668

General Information
piRBase Id piR-mmu-4668 Accession DQ695488
Organism Mouse Number of methods 5
Sequence TGGAATTTAGTGTCAGTCTGACTGGATGGA Number of papers 13
Length 30 Golden piRNA Y
Aliases piR-20187; piR-110810; PIR14186; PIR204136;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 5 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 425 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 373 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 342 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 598 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 1241 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 495 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 397 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 113 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 25 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 19 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 16 21602304 small RNA Male germ cell, Round spermatids
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 474 20022248 Miwi IP adult testis
133 GSM475280 10 20022248 Mili IP adult testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 95 25582079 MIWI CLIP round spermatids
225 GSM1528807 126 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 297 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 250 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 260 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 8 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 11 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 12 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 474 20022248 Miwi-IP testis 
346 GSM475280 10 20022248 Mili-IP testis 
347 GSM475281 17 20022248 small RNA testis 
441 GSM1096582 4 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 35 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 16 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 28 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 100 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 22 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 27 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 37 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 59 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 31 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 57 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:81900324-81900354:- LTR ERV1 RMER5;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.8735
GSM433289 2.4062
GSM433290 2.5485
GSM433291 1.4229
GSM433292 2.9175
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 45.5289
GSM475280 0.9092
GSM475281 1.5948
GSM678422 0
The Expression of piRNA: piR-mmu-4668
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Cox7a2 NM_009945 deadenylation mm9 chr9:79603178-79603197:- n 24787618
1700015F17Rik NM_001200025 deadenylation mm9 chr5:5437854-5437873:- n 24787618
4933411K16Rik NM_025752 deadenylation mm9 chr19:42127925-42127944:+ n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.