Loading...

Detail Information of piRNA: piR-mmu-464

General Information
piRBase Id piR-mmu-464 Accession DQ549222
Organism Mouse Number of methods 3
Sequence TGCAGAGGGAATGTGGAATGTTCAGGA Number of papers 8
Length 27 Golden piRNA -
Aliases piR-17334; PIR10333;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 5 20022248 Miwi IP adult testis
133 GSM475280 5 20022248 Mili IP adult testis
225 GSM1528807 17 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 29 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 22 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 20 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 7 26115953 small RNA 18dpp homo tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 5 20022248 Miwi-IP testis 
346 GSM475280 5 20022248 Mili-IP testis 
347 GSM475281 3 20022248 small RNA testis 
441 GSM1096582 7 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 140 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 34 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 141 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 113 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 22 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 7 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 22 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 12 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 26 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 10 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:73792361-73792388:- Gm10619 ENSMUST00000186073;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 1.5312
GSM433290 0
GSM433291 0.3557
GSM433292 0.2431
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.4803
GSM475280 0.4546
GSM475281 0.2814
GSM678422 0
The Expression of piRNA: piR-mmu-464
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.