Loading...

Detail Information of piRNA: piR-mmu-4625

General Information
piRBase Id piR-mmu-4625 Accession DQ553036
Organism Mouse Number of methods 4
Sequence TGGAATGGGATAGATGGGATGTCGGACGGG Number of papers 7
Length 30 Golden piRNA -
Aliases piR-20148; PIR14147;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 14 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 20 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 10 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 17 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 28 25582079 MIWI CLIP round spermatids
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
227 GSM1528809 14 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 16 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 2 26115953 small RNA 25dpp hetero tdrd6 KO testes
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 5 23523368 oxidized small RNA Wild Type 12.5 dpp testes
446 GSM1096601 15 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 4 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 9 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 5 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 24 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 10 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 18 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:73818697-73818727:+ Gm21269 ENSMUST00000206521;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 1.3124
GSM433290 0.4247
GSM433291 0
GSM433292 0.7294
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-4625
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Akap1 NM_001042541 deadenylation mm9 chr11:88692820-88692839:- n 24787618
Nek2 NM_010892 deadenylation mm9 chr1:193655743-193655762:+ n 24787618
Clip4 NM_030179 deadenylation mm9 chr17:72206273-72206292:+ n 24787618
Agpat1 NM_018862 deadenylation mm9 chr17:34750231-34750250:+ n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.