Loading...
piRBase Id | piR-mmu-459 | Accession | DQ549218 |
---|---|---|---|
Organism | Mouse | Number of methods | 2 |
Sequence | TGCAGAGGAGCAAACGAACAAATCAC | Number of papers | 8 |
Length | 26 | Golden piRNA | - |
Aliases | piR-17330; PIR10329; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
14 | GSM822761 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
63 | GSM319959 | 4 | 18922463 | small RNA | 2 dpp testis |
64 | GSM319960 | 15 | 18922463 | small RNA | 10 dpp testis |
65 | GSM319961 | 1 | 18922463 | small RNA | 10 dpp MILI KO testis |
119 | GSM958040 | 1 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
121 | GSM545783 | 1 | 20534472 | Mov10L1 IP | wild type adult testis |
126 | GSM466728 | 6 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
129 | GSM466729 | 3 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 4 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 1 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
235 | GSM433289 | 1 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 10:61430193-61430219:- | Eif4ebp2 ENSMUST00000020288; | SINE Alu B1_Mus2; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 2.732 |
GSM319960 | 7.4862 |
GSM319961 | 2.0518 |
GSM400967 | 0.3107 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0.3344 |
GSM433288 | 0 |
GSM433289 | 0.2187 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
---|---|---|---|
Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. |
PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
---|---|---|---|
Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |