Loading...

Detail Information of piRNA: piR-mmu-459

General Information
piRBase Id piR-mmu-459 Accession DQ549218
Organism Mouse Number of methods 2
Sequence TGCAGAGGAGCAAACGAACAAATCAC Number of papers 8
Length 26 Golden piRNA -
Aliases piR-17330; PIR10329;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
63 GSM319959 4 18922463 small RNA 2 dpp testis
64 GSM319960 15 18922463 small RNA 10 dpp testis
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 6 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 3 20059948 Mili IP Tdrd9+/- 14dpp testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 4 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:61430193-61430219:- Eif4ebp2 ENSMUST00000020288; SINE Alu B1_Mus2;
piRNA Expression
The Expression of piRNA: piR-mmu-459
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ