Loading...

Detail Information of piRNA: piR-mmu-456702

General Information
piRBase Id piR-mmu-456702 Accession N/A
Organism Mouse Number of methods 3
Sequence TAGGACAATGGAAGGGAACGCAAA Number of papers 8
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
121 GSM545783 15 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 4 20022248 Miwi IP adult testis
133 GSM475280 26 20022248 Mili IP adult testis
225 GSM1528807 30 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 38 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 35 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 51 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 4 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 4 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 4 20022248 Miwi-IP testis 
346 GSM475280 26 20022248 Mili-IP testis 
347 GSM475281 12 20022248 small RNA testis 
359 GSM4635232 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
441 GSM1096582 15 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 76 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 7 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 25 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 75 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 18 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 10 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 27 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 12 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 28 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 8 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27345849-27345873:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 9.9414
Sample CPM
GSM400968 1.1724
GSM400969 0
GSM433288 0.2342
GSM433289 0.875
GSM433290 0.8495
GSM433291 0.3557
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.3842
GSM475280 2.3639
GSM475281 1.1258
GSM678422 0
The Expression of piRNA: piR-mmu-456702
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.