Loading...

Detail Information of piRNA: piR-mmu-4531

General Information
piRBase Id piR-mmu-4531 Accession DQ552936
Organism Mouse Number of methods 4
Sequence TGGAAGTGTAGGATACCCGTGCAGAAGGTC Number of papers 13
Length 30 Golden piRNA -
Aliases piR-20048; PIR14047;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1695 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 580 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1349 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 925 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 127 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 37 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 34 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 6 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 44 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 3 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 6 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 138 20022248 Miwi IP adult testis
133 GSM475280 20 20022248 Mili IP adult testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 92 25582079 MIWI CLIP round spermatids
225 GSM1528807 85 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 289 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 219 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 209 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 7 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 138 20022248 Miwi-IP testis 
346 GSM475280 20 20022248 Mili-IP testis 
347 GSM475281 161 20022248 small RNA testis 
441 GSM1096582 23 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 50 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 17 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 9 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 257 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 60 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 64 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 120 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 196 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 209 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 270 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:79335532-79335562:- Cdc42ep3 ENSMUST00000068958; Cdc42ep3 ENSMUST00000233363; LTR ERVL-MaLR MTC;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.6393
GSM433289 1.3124
GSM433290 1.4866
GSM433291 0.3557
GSM433292 2.9175
GSM433293 3.403
GSM433294 0
GSM433295 0
GSM475279 13.2552
GSM475280 1.8184
GSM475281 15.1038
GSM678422 0.1061
The Expression of piRNA: piR-mmu-4531
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Prok2 NM_015768 deadenylation mm9 chr6:99661871-99661890:- n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.