Loading...

Detail Information of piRNA: piR-mmu-452212

General Information
piRBase Id piR-mmu-452212 Accession N/A
Organism Mouse Number of methods 3
Sequence TAGATAGATAGATAGATAGATAGATAGATA Number of papers 8
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 4 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
16 GSM822763 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
73 N/A 3 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 13 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 11 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 2 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 4 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 9 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
82 N/A 1 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 4 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 3 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 2 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 68 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 16 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 6 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
349 GSM3772907 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 7 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
358 GSM4635231 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
140600 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 X:150536457-150536487:+ Apex2 ENSMUST00000112725; Apex2 ENSMUST00000112727;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.2347
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-452212
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.