Loading...
piRBase Id | piR-mmu-45 | Accession | DQ539893 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | AAAAAAAAACACAAGGATTTGATTGCCAAG | Number of papers | 5 |
Length | 30 | Golden piRNA | - |
Aliases | piR-5; PIR1004; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
11 | GSM822760 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
12 | GSM822758 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
15 | GSM822762 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
17 | GSM822764 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
35 | GSM684620 | 1 | 22842725 | Mili CLIP | C57BL/6 adult testis |
225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 4 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
228 | GSM1528810 | 3 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
235 | GSM433289 | 1 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 5:149808893-149808923:- | Gm21221 ENSMUST00000202876; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0.2187 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |