Loading...
| piRBase Id | piR-mmu-444353 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 2 |
| Sequence | TACTGGAACTGCACAAACTGGCTACTGACA | Number of papers | 6 |
| Length | 30 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 13 | GSM822759 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 73 | N/A | 2 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
| 74 | N/A | 2 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
| 116 | GSM958037 | 4 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 117 | GSM958038 | 8 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
| 119 | GSM958040 | 1 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
| 225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 356 | GSM4635229 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male) |
| 443 | GSM1096583 | 6 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 2 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 451 | GSM1096587 | 1 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 19:9984641-9984671:+ | Fth1 ENSMUST00000235196; Fth1 ENSMUST00000025563; Fth1 ENSMUST00000237316; Fth1 ENSMUST00000235407; Fth1 ENSMUST00000237465; Fth1 ENSMUST00000235129; Fth1 ENSMUST00000236195; Fth1 ENSMUST00000236403; | |
| Location 2 | X:90744688-90744718:- | Gm6977 ENSMUST00000121568; | LINE L1 L1M3d; Simple_repeat Simple_repeat (GGAAGG)n; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
|---|---|---|---|
| Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
| Authors | Bloom JC, Schimenti JC. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||