Loading...

Detail Information of piRNA: piR-mmu-4435

General Information
piRBase Id piR-mmu-4435 Accession DQ540285
Organism Mouse Number of methods 3
Sequence ATCGATGTGGTGCTCCGGAGTTCTCTTCGGGC Number of papers 6
Length 32 Golden piRNA -
Aliases piR-397; PIR1396;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 9 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
122 N/A 1433 21515829 small RNA hippocampus
132 GSM475279 9 20022248 Miwi IP adult testis
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
240 GSM433294 2 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
442 GSM1096599 84 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 48 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 11 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 53 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 3 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:39842998-39843030:+ LINE L1 Lx2B2;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 1.6441
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.4693
GSM433295 0
GSM475279 0.8645
GSM475280 0
GSM475281 0.5629
GSM678422 0
The Expression of piRNA: piR-mmu-4435
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.