Loading...

Detail Information of piRNA: piR-mmu-4335

General Information
piRBase Id piR-mmu-4335 Accession DQ552728
Organism Mouse Number of methods 3
Sequence TAACACCGGCCGGAAGATTAGTGAGC Number of papers 11
Length 26 Golden piRNA -
Aliases piR-2840; PIR13839;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
64 GSM319960 2 18922463 small RNA 10 dpp testis
69 GSM509278 2 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 1 20439430 small RNA MVH-/- E16.5 testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
118 GSM958039 3 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 9 22902560 Mili IP Tdrd1 -/-,E18,testis
126 GSM466728 5 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 6 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 1 20059948 Mili IP Tdrd9-/- 14dpp testis
133 GSM475280 2 20022248 Mili IP adult testis
228 GSM1528810 2 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
346 GSM475280 2 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
444 GSM1096600 1 23523368 oxidized small RNA Wild Type 12.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:146959031-146959057:- Mtif3 ENSMUST00000066675; Mtif3 ENSMUST00000016654; Mtif3 ENSMUST00000110566; Mtif3 ENSMUST00000110564; Mtif3 ENSMUST00000125217; Mtif3 ENSMUST00000140526;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0.9982
GSM319961 0
GSM400967 0.6213
Sample CPM
GSM400968 0.7816
GSM400969 0.3344
GSM433288 0
GSM433289 0.2187
GSM433290 0.2124
GSM433291 0
GSM433292 0.2431
GSM433293 0
GSM433294 0
GSM433295 0.4757
GSM475279 0
GSM475280 0.1818
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-4335
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.