Loading...
piRBase Id | piR-mmu-4300 | Accession | DQ552696 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TAACAACTCACCTGCCGAATCAACTAGCCC | Number of papers | 8 |
Length | 30 | Golden piRNA | - |
Aliases | piR-2808; PIR13807; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
13 | GSM822759 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
57 | GSM319953 | 2 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
58 | GSM319954 | 1 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
80 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_2 E16.5 fetal testis |
86 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
114 | GSM958035 | 2 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
115 | GSM958036 | 4 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
116 | GSM958037 | 6 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 30 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
119 | GSM958040 | 9 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
120 | GSM958041 | 19 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 3 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 4 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 15 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
246 | GSM1318059 | 13 | 25262350 | small RNA | E16.5 whole testes |
247 | GSM1318060 | 8 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
443 | GSM1096583 | 6 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 11 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 10 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 29 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
451 | GSM1096587 | 1 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 18:85698233-85698263:- | Simple_repeat Simple_repeat (AC)n; | |
Location 2 | 9:110281284-110281314:+ | Mir6236 ENSMUST00000184437; | SINE B2 B2_Mm1t; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 1.5076 |
GSM319954 | 0.4649 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0.0531 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
---|---|---|---|
Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |