Loading...
| piRBase Id | piR-mmu-425301 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 1 |
| Sequence | TAAGATCCAACTGTAAGGCATTTTCTCAATT | Number of papers | 2 |
| Length | 31 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 2:27051713-27051744:+ | ||
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| No record. |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| Hmmr | NM_013552 | cleavage | mm9 chr11:40515856-40515876:- | n | 25582079 |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||