Loading...

Detail Information of piRNA: piR-mmu-42

General Information
piRBase Id piR-mmu-42 Accession DQ548926
Organism Mouse Number of methods 3
Sequence TGCAAGTGCTCTTAAGAAGGATAATCCCAG Number of papers 5
Length 30 Golden piRNA -
Aliases piR-17038; PIR10037;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
12 GSM822758 3 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
225 GSM1528807 10 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 9 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 4 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 9 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 2 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:73779777-73779807:- LTR ERVL-MaLR MLT1A;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.2187
GSM433290 0.2124
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-42
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.