Loading...

Detail Information of piRNA: piR-mmu-419

General Information
piRBase Id piR-mmu-419 Accession DQ686682
Organism Mouse Number of methods 5
Sequence TGCAGAAAACTGTGCACATTCGATGTCTA Number of papers 11
Length 29 Golden piRNA -
Aliases piR-17293; piR-102004; PIR10292; PIR195330;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 11 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 390 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 286 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 373 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 526 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 30 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 525 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 64 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 39 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 8 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 34 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 102 21602304 small RNA Male germ cell, Round spermatids
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
225 GSM1528807 740 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 315 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 179 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 137 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 21 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 10 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 49 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 18 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 8 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 3 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 4 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 6 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113333588-113333617:- LTR ERVK RLTR11A;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.918
GSM433289 2.1874
GSM433290 10.4063
GSM433291 6.4031
GSM433292 20.6659
GSM433293 18.2914
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-419
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.