Loading...

Detail Information of piRNA: piR-mmu-40995

General Information
piRBase Id piR-mmu-40995 Accession DQ560774
Organism Mouse Number of methods 4
Sequence TTACCACTTAGAACACAGGATGTCAGCGC Number of papers 15
Length 29 Golden piRNA Y
Aliases piR-27886; PIR21885;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 79 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1434 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 234 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 95 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 36 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 38 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 67 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 17 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 19 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 3 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 27 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 23 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 72 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 88 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 58 18922463 small RNA 16.5 dpc testis
60 GSM319956 2 18922463 Mili IP 16.5 dpc testis
61 GSM319957 167 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 10 18922463 small RNA 4-6 week ovary
66 GSM509275 35 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 31 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 22 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 7 20439430 small RNA MVH-/- E16.5 testis
71 GSM509280 8 20439430 small RNA MitoPLD-/- 10 dpp testis
72 GSM179088 17 17446352 Mili IP 10 dpp testis
73 N/A 7 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
75 N/A 22 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 49 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 12 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 5 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 4 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 12 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 34 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 29 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 17 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 4 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 198 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 162 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 43 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 231 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 11 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 29 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 333 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 889 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 184 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
224 GSM1528806 268 26588211 small RNA 10dpp testes
225 GSM1528807 296 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 408 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 366 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 274 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 175 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 165 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 268 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 38 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 25 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 22 25262350 small RNA E16.5 whole testes
247 GSM1318060 7 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
348 GSM3772906 217 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 157 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 353 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 342 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 323 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 313 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
361 GSM2500213 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
363 GSM2500215 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
364 GSM2500216 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
365 GSM2500217 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
441 GSM1096582 93 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 1629 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 2064 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 3305 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 2409 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 3916 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 177 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 387 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 458 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 504 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 250 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 177 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2627 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:143988764-143988793:+ LTR LTR RLTR4_MM-int;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 94.0427
GSM261957 0
GSM261958 18.9076
GSM261959 0
GSM319953 54.2723
GSM319954 40.9121
GSM319955 35.1951
GSM319956 4.2404
GSM319957 86.0686
GSM319958 16.1135
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 40.9831
GSM433289 36.0923
GSM433290 56.9162
GSM433291 13.5176
GSM433292 39.6299
GSM433293 54.8742
GSM433294 5.8663
GSM433295 1.9027
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-40995
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.