Loading...
| piRBase Id | piR-mmu-4 | Accession | DQ710002 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 5 |
| Sequence | TGCAAGGTCGCAAGGTCGCAAGGTCGAGGC | Number of papers | 10 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-17003; piR-125324; PIR10002; PIR218650; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 6 | GSM113695 | 2 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
| 16 | GSM822763 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 17 | GSM822764 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 32 | GSM684625 | 1 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 5 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 36 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 121 | GSM545783 | 1 | 20534472 | Mov10L1 IP | wild type adult testis |
| 217 | GSM1653802 | 29 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 71 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 78 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 105 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 82 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 2 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 7 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 10 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 441 | GSM1096582 | 7 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 56 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 8 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 17 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 95 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 9 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 9 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 27 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 27 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 64 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 33 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 5:143766573-143766603:+ | D130017N08Rik ENSMUST00000180460; D130017N08Rik ENSMUST00000199836; D130017N08Rik ENSMUST00000196629; | LTR LTR RLTR4_MM-int; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.4684 |
| GSM433289 | 1.5312 |
| GSM433290 | 2.1237 |
| GSM433291 | 0 |
| GSM433292 | 3.6469 |
| GSM433293 | 2.5523 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
|---|---|---|---|
| Title | Characterization of the piRNA complex from rat testes. | ||
| Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||