Loading...

Detail Information of piRNA: piR-mmu-39951

General Information
piRBase Id piR-mmu-39951 Accession DQ709248
Organism Mouse Number of methods 5
Sequence TGCTAGTGTATGCAATGGTGTCAGCGTT Number of papers 14
Length 28 Golden piRNA Y
Aliases piR-124570; PIR217896;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
32 GSM684625 3 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
57 GSM319953 24 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 64 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 41 18922463 small RNA 16.5 dpc testis
60 GSM319956 1 18922463 Mili IP 16.5 dpc testis
61 GSM319957 78 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 194 18922463 small RNA 4-6 week ovary
72 GSM179088 1 17446352 Mili IP 10 dpp testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
116 GSM958037 648 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 30 22902560 Mili IP Fkbp6 -/-,P10,testis
132 GSM475279 3 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
224 GSM1528806 24 26588211 small RNA 10dpp testes
225 GSM1528807 3 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 4 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 5 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 16 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 15 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 10 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 3 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 3 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
345 GSM475279 3 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
360 GSM2500212 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
361 GSM2500213 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
362 GSM2500214 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
363 GSM2500215 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
364 GSM2500216 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
365 GSM2500217 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 215 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 25 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 87 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 8 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 17 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 2 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
19240 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 12:15198206-15198234:-
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 309.92
GSM261959 22.5288
GSM319953 18.0908
GSM319954 29.7542
GSM319955 24.8793
GSM319956 2.1202
GSM319957 40.1997
GSM319958 312.6017
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.747
GSM433289 3.2811
GSM433290 2.1237
GSM433291 1.0672
GSM433292 0.2431
GSM433293 1.7015
GSM433294 0.704
GSM433295 0.7135
GSM475279 0.2882
GSM475280 0.1818
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-39951
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.