Loading...

Detail Information of piRNA: piR-mmu-39659

General Information
piRBase Id piR-mmu-39659 Accession DQ708948
Organism Mouse Number of methods 5
Sequence TTACCACTTAGAACACAGGATGTCAGC Number of papers 16
Length 27 Golden piRNA Y
Aliases piR-124270; PIR217596;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 14 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 53 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
32 GSM684625 4 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 267 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1445 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 117 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 84 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 81 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 6 18922463 small RNA 16.5 dpc testis
61 GSM319957 19 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 2 18922463 small RNA 4-6 week ovary
66 GSM509275 23 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 2 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 9 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 14 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 7 20439430 small RNA MVH-/- E16.5 testis
71 GSM509280 5 20439430 small RNA MitoPLD-/- 10 dpp testis
72 GSM179088 3 17446352 Mili IP 10 dpp testis
73 N/A 2 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 2 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 33 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 90 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 17 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 18 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 2 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 12 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 61 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 44 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 6 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 2 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 132 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 78 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 26 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 119 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 4 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 17 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 85 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 377 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 10 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 4 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 166 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 33 20022248 Miwi IP adult testis
133 GSM475280 410 20022248 Mili IP adult testis
224 GSM1528806 49 26588211 small RNA 10dpp testes
225 GSM1528807 127 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 132 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 150 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 100 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 87 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 66 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 96 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 19 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 3 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 14 25262350 small RNA E16.5 whole testes
247 GSM1318060 8 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 33 20022248 Miwi-IP testis 
346 GSM475280 410 20022248 Mili-IP testis 
347 GSM475281 35 20022248 small RNA testis 
348 GSM3772906 135 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 87 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 148 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 131 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 150 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 141 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
363 GSM2500215 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
364 GSM2500216 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
365 GSM2500217 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
441 GSM1096582 96 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 965 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 726 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 1273 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 978 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1942 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 74 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 374 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 294 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 547 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 157 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 268 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2721 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:93581262-93581289:+ Gm12649 ENSMUST00000137509;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 16.5958
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 63.3177
GSM319954 37.6577
GSM319955 3.6409
GSM319956 0
GSM319957 9.7922
GSM319958 3.2227
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 20.3745
GSM433289 14.4369
GSM433290 20.3879
GSM433291 6.7588
GSM433292 10.9408
GSM433293 17.4406
GSM433294 0.704
GSM433295 0
GSM475279 3.1697
GSM475280 37.2773
GSM475281 3.2834
GSM678422 0
The Expression of piRNA: piR-mmu-39659
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.