Loading...

Detail Information of piRNA: piR-mmu-392483

General Information
piRBase Id piR-mmu-392483 Accession N/A
Organism Mouse Number of methods 2
Sequence GAGGTCAGCCTGGGCTACATAGTGAGCT Number of papers 5
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 13 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
132 GSM475279 8 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 5 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 6 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 11 26588211 small RNA Adult testes Asb1 ao36(KO)
345 GSM475279 8 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:92577755-92577783:+ SINE MIR MIR3;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0.4863
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.7684
GSM475280 0.1818
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-392483
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
NONMMUT001740 cleavage mm9 chr1:84737978-84737998:- n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.