Loading...

Detail Information of piRNA: piR-mmu-39

General Information
piRBase Id piR-mmu-39 Accession DQ689483
Organism Mouse Number of methods 5
Sequence TGCAAGTGCGCTGACTTCCATTGGCACGAT Number of papers 10
Length 30 Golden piRNA Y
Aliases piR-17035; piR-104805; PIR10034; PIR198131;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 5 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 17 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 39 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 33 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 28 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 21 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 8 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 179 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 45 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 108 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 8 22842725 Miwi CLIP C57BL/6 adult testis
37 GSM684622 1 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 13 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 2 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 289 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1512 21602304 small RNA Male germ cell, Round spermatids
132 GSM475279 696 20022248 Miwi IP adult testis
133 GSM475280 31 20022248 Mili IP adult testis
217 GSM1653802 1008 25582079 MIWI CLIP round spermatids
225 GSM1528807 466 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1304 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 927 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1581 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 115 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 121 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 326 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 37 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 696 20022248 Miwi-IP testis 
346 GSM475280 31 20022248 Mili-IP testis 
347 GSM475281 331 20022248 small RNA testis 
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 13 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 21 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 24 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 7 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 85 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 29 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 65 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 29 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27320147-27320177:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 26.9318
GSM433289 26.4677
GSM433290 69.2339
GSM433291 13.1619
GSM433292 96.5219
GSM433293 102.0915
GSM433294 0
GSM433295 0
GSM475279 66.8525
GSM475280 2.8185
GSM475281 31.052
GSM678422 0
The Expression of piRNA: piR-mmu-39
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.