Loading...

Detail Information of piRNA: piR-mmu-38847

General Information
piRBase Id piR-mmu-38847 Accession DQ708131
Organism Mouse Number of methods 4
Sequence TATCTGTGAGGATAAGTAACTCTGAGG Number of papers 12
Length 27 Golden piRNA -
Aliases piR-123453; PIR216779;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
50 GSM610965 31 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 30 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 8 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 242 18922463 small RNA 16.5 dpc testis
61 GSM319957 2 18922463 Miwi2 IP 16.5 dpc testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
122 N/A 115 21515829 small RNA hippocampus
132 GSM475279 18 20022248 Miwi IP adult testis
133 GSM475280 4 20022248 Mili IP adult testis
224 GSM1528806 41 26588211 small RNA 10dpp testes
225 GSM1528807 393 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 325 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 296 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 315 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 47 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 22 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 28 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 5 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 181 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 404 25262350 small RNA E16.5 whole testes
247 GSM1318060 416 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 18 20022248 Miwi-IP testis 
346 GSM475280 4 20022248 Mili-IP testis 
347 GSM475281 59 20022248 small RNA testis 
348 GSM3772906 2368 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 2589 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 5424 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 2835 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 2826 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 2947 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 118 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 63 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 11011 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 310 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1665 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1630 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 97 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 4 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 129 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 137 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 19:8724033-8724060:+ Snhg1 ENSMUST00000206155; Snhg1 ENSMUST00000206519; Snhg1 ENSMUST00000205539; Gm25855 ENSMUST00000082787; Snhg1 ENSMUST00000205909; SINE B2 B3;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0.6375
GSM261958 92.0717
GSM261959 8.7612
GSM319953 0
GSM319954 0
GSM319955 146.8484
GSM319956 0
GSM319957 1.0308
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 11.0069
GSM433289 4.8123
GSM433290 5.9465
GSM433291 1.7786
GSM433292 6.0782
GSM433293 6.3807
GSM433294 42.4717
GSM433295 103.4589
GSM475279 1.7289
GSM475280 0.3637
GSM475281 5.5349
GSM678422 30.4561
The Expression of piRNA: piR-mmu-38847
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.