Loading...

Detail Information of piRNA: piR-mmu-3826

General Information
piRBase Id piR-mmu-3826 Accession DQ552265
Organism Mouse Number of methods 4
Sequence TAAAATTGGATGTCTAGGATAATGATT Number of papers 9
Length 27 Golden piRNA -
Aliases piR-2377; PIR13376;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
31 GSM684624 10 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 1 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 82 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 1 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 22 22842725 Mili CLIP C57BL/6 adult testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
73 N/A 13 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 3 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 5 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
81 N/A 3 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 3 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 1 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 2 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
88 N/A 3 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
133 GSM475280 5 20022248 Mili IP adult testis
225 GSM1528807 3 26588211 small RNA Adult testes Asb1 ao31(Het)
227 GSM1528809 6 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 3 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 22 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 11 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 10 26115953 small RNA 25dpp homo tdrd6 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
346 GSM475280 5 20022248 Mili-IP testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 80 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 47 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 170 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 114 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 16 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 21 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 21 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 27 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 10 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 7 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
20 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 12:18471349-18471376:-
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 0.5154
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 5.1522
GSM433289 1.3124
GSM433290 2.3361
GSM433291 3.5573
GSM433292 1.2156
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.4546
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-3826
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.