Loading...

Detail Information of piRNA: piR-mmu-381482

General Information
piRBase Id piR-mmu-381482 Accession N/A
Organism Mouse Number of methods 2
Sequence CTTTATCACAGCAACAGACAGTAACTCAGA Number of papers 2
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:31988169-31988199:+ Hsf2bp ENSMUST00000238192; Hsf2bp ENSMUST00000002145; Hsf2bp ENSMUST00000133308; Hsf2bp ENSMUST00000237527; Hsf2bp ENSMUST00000236321; LTR ERVL-MaLR MTE2b;
piRNA Expression
No record.
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Fam206a NM_001081420 cleavage mm9 chr4:56821998-56822018:+ n 25582079
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.