Loading...

Detail Information of piRNA: piR-mmu-378

General Information
piRBase Id piR-mmu-378 Accession DQ550104
Organism Mouse Number of methods 4
Sequence TGCCATGGTGCCCTCCTTGTACCTTGGA Number of papers 7
Length 28 Golden piRNA -
Aliases piR-18216; PIR11215;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
35 GSM684620 4 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 81 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 70 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 1 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
132 GSM475279 5 20022248 Miwi IP adult testis
133 GSM475280 3 20022248 Mili IP adult testis
225 GSM1528807 22 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 46 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 51 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 51 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
345 GSM475279 5 20022248 Miwi-IP testis 
346 GSM475280 3 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
443 GSM1096583 6 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 10 23523368 small RNA Wild Type 14.5 dpp testes
449 GSM1096586 8 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 3 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:67728155-67728183:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.4803
GSM475280 0.2728
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-378
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.