Loading...
| piRBase Id | piR-mmu-370750 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 1 |
| Sequence | CGATTGAGCGGCAAGCTCCACCCCTGAGCAA | Number of papers | 1 |
| Length | 31 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 4:34928593-34928624:+ | LTR ERVK RLTRETN_Mm; | |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| No record. |
| No record. |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| NONMMUT001276 | cleavage | mm9 chr1:64624617-64624637:+ | n | N/A |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||