Loading...

Detail Information of piRNA: piR-mmu-3573

General Information
piRBase Id piR-mmu-3573 Accession DQ687523
Organism Mouse Number of methods 5
Sequence TAAAAGATAGAACTCTTCACACGAGGTGCT Number of papers 14
Length 30 Golden piRNA Y
Aliases piR-2249; piR-102845; PIR13248; PIR196171;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 20 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 3486 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1753 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1768 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1704 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1418 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 282 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 223 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 296 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 119 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 18 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 39 22842725 Miwi CLIP C57BL/6 adult testis
38 GSM684623 1 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 7 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 5 20439430 small RNA MitoPLD-/- E16.5 testis
121 GSM545783 12 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 122 20022248 Miwi IP adult testis
133 GSM475280 3 20022248 Mili IP adult testis
217 GSM1653802 23 25582079 MIWI CLIP round spermatids
225 GSM1528807 43 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 132 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 176 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 99 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 49 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 23 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 176 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 41 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 122 20022248 Miwi-IP testis 
346 GSM475280 3 20022248 Mili-IP testis 
347 GSM475281 49 20022248 small RNA testis 
348 GSM3772906 17 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
354 GSM4635227 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
441 GSM1096582 93 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 82 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 3 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 139 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 591 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 532 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 159 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 482 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 224 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 780 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 554 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:52908802-52908832:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 1.864
Sample CPM
GSM400968 0
GSM400969 2.0065
GSM433288 11.4753
GSM433289 5.031
GSM433290 37.3778
GSM433291 14.5848
GSM433292 68.8053
GSM433293 42.1127
GSM433294 0
GSM433295 0
GSM475279 11.7184
GSM475280 0.2728
GSM475281 4.5968
GSM678422 0
The Expression of piRNA: piR-mmu-3573
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.