Loading...

Detail Information of piRNA: piR-mmu-357084

General Information
piRBase Id piR-mmu-357084 Accession N/A
Organism Mouse Number of methods 3
Sequence CAGAAGTGATGAAACAAATGGATCTGACA Number of papers 8
Length 29 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
60 GSM319956 1 18922463 Mili IP 16.5 dpc testis
61 GSM319957 2 18922463 Miwi2 IP 16.5 dpc testis
66 GSM509275 18 20439430 small RNA MitoPLD+/+ E16.5 testis
69 GSM509278 1 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 8 20439430 small RNA MVH-/- E16.5 testis
71 GSM509280 3 20439430 small RNA MitoPLD-/- 10 dpp testis
74 N/A 8 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 11 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
77 N/A 1 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 2 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
83 N/A 3 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 2 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 3 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 26 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 33 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
117 GSM958038 8 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 11 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 10 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
226 GSM1528808 2 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
357 GSM4635230 2 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 23 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
Location in GRCm38
3860 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 Y:687856-687885:- Gm2098 ENSMUST00000189146; LINE L1 L1MdTf_III;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 2.1202
GSM319957 1.0308
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-357084
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.