Loading...

Detail Information of piRNA: piR-mmu-3520

General Information
piRBase Id piR-mmu-3520 Accession DQ540209
Organism Mouse Number of methods 4
Sequence AGGCATCTCTTGATTTGTGACTGACGGTT Number of papers 10
Length 29 Golden piRNA -
Aliases piR-321; PIR1320;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1229 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 656 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1299 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 276 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 135 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 377 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 98 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
51 GSM610966 60 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 41 21602304 small RNA Male germ cell, Round spermatids
121 GSM545783 26 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 1 20059948 Mili IP Tdrd9+/- 14dpp testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 70 25582079 MIWI CLIP round spermatids
225 GSM1528807 221 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 455 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 582 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 455 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 18 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 19 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 12 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 20 26115953 small RNA 6 weeks hetero tdrd6 KO testes
441 GSM1096582 28 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 86 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 16 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 57 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 237 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 65 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 69 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 58 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 102 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 118 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 137 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:92994941-92994970:-
piRNA Expression
Sample CPM
GSM400968 1.1724
GSM400969 0
GSM433288 1.6393
GSM433289 3.9373
GSM433290 4.0351
GSM433291 4.2687
GSM433292 4.8626
GSM433293 1.7015
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.2653
The Expression of piRNA: piR-mmu-3520
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Tcf20 NM_001114140 deadenylation mm9 chr15:82639453-82639472:- n 24787618
Med1 NM_001080118 deadenylation mm9 chr11:98016107-98016126:- n 24787618
Pdzk1 NM_001146001 deadenylation mm9 chr3:96674384-96674403:+ n 24787618
Rab11fip5 NM_001003955 deadenylation mm9 chr6:85286201-85286220:- n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.