Loading...

Detail Information of piRNA: piR-mmu-3439

General Information
piRBase Id piR-mmu-3439 Accession DQ707580
Organism Mouse Number of methods 5
Sequence TAAAAAGGTGAGTCCTACATTGTGAATGGC Number of papers 12
Length 30 Golden piRNA -
Aliases piR-2127; piR-122902; PIR13126; PIR216228;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 8 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 31 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 30 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 19 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 41 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 34 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 949 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 131 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 49 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 2 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 29 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 2 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 3 18922463 Mili IP 10 dpp Dnmt3L KO testis
73 N/A 6 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 3 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
83 N/A 2 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 2 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
88 N/A 2 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 12 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
217 GSM1653802 102 25582079 MIWI CLIP round spermatids
225 GSM1528807 33 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 91 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 87 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 50 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 17 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 11 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 38 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 6 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 24 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 152 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 220 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 87 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 298 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 50 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 249 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 88 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 288 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 138 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 338 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:111006358-111006388:- Ddx19b ENSMUST00000040241; Simple_repeat Simple_repeat (A)n;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 1.5076
GSM319954 1.3947
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 3.9812
GSM433289 2.4062
GSM433290 8.0702
GSM433291 2.1344
GSM433292 8.9957
GSM433293 4.6792
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.5306
The Expression of piRNA: piR-mmu-3439
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.