Loading...
| piRBase Id | piR-mmu-34 | Accession | DQ539892 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 1 |
| Sequence | TGACATGAACACAGGTGCTCAAATAGCTTT | Number of papers | 3 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-4; PIR1003; | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 9:67709551-67709581:- | Low_complexity Low_complexity GA-rich; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0.0938 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||