Loading...

Detail Information of piRNA: piR-mmu-33785642

General Information
piRBase Id piR-mmu-33785642 Accession N/A
Organism Mouse Number of methods 3
Sequence GTGCATTGTAGTTGCATTGCA Number of papers 3
Length 21 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 3 22902560 Mili IP Fkbp6 -/-,P0,testis
118 GSM958039 2 22902560 Mili IP Tdrd1 +/-,E18,testis
132 GSM475279 290 20022248 Miwi IP adult testis
133 GSM475280 61 20022248 Mili IP adult testis
441 GSM1096582 158 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 342 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1615 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 19 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 3536 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 673 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 26 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 45 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 27 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:82198126-82198147:+ Srebf2 ENSMUST00000023100; Srebf2 ENSMUST00000229336; Srebf2 ENSMUST00000230955; Mir33 ENSMUST00000083531;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.2786
GSM433289 2.4062
GSM433290 0.2124
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 25.8115
GSM433295 19.2648
GSM475279 27.8552
GSM475280 5.5461
GSM475281 155.26
GSM678422 0
The Expression of piRNA: piR-mmu-33785642
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.