Loading...

Detail Information of piRNA: piR-mmu-333492

General Information
piRBase Id piR-mmu-333492 Accession N/A
Organism Mouse Number of methods 2
Sequence AGCTGAAAAGTTCTGAATTCATACAGTTGAA Number of papers 3
Length 31 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
356 GSM4635229 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
Location in GRCm38
1137 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:123749303-123749334:+ Ccr9 ENSMUST00000163559; SINE B2 B3A;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.