Loading...

Detail Information of piRNA: piR-mmu-333

General Information
piRBase Id piR-mmu-333 Accession DQ713058
Organism Mouse Number of methods 5
Sequence TGCCAAAGTGTTGAGGGGACCGCCTG Number of papers 10
Length 26 Golden piRNA Y
Aliases piR-17710; piR-128380; PIR10709; PIR221706;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
35 GSM684620 38 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 35 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 18 22842725 Mili CLIP C57BL/6 adult testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
121 GSM545783 7 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 39 20022248 Mili IP adult testis
217 GSM1653802 16 25582079 MIWI CLIP round spermatids
225 GSM1528807 9 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 9 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 18 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 7 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 9 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 19 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 7 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 39 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
443 GSM1096583 4 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 3 23523368 small RNA Wild Type 14.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 6 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 4 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 3 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 2 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 12:98401684-98401710:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 1.2427
Sample CPM
GSM400968 0.7816
GSM400969 0
GSM433288 2.1077
GSM433289 4.1561
GSM433290 1.4866
GSM433291 0.7115
GSM433292 4.6194
GSM433293 2.1269
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 3.5459
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-333
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.