Loading...

Detail Information of piRNA: piR-mmu-3321

General Information
piRBase Id piR-mmu-3321 Accession DQ540188
Organism Mouse Number of methods 3
Sequence AGCTGGTGTTGTGAATCAGGCCGTT Number of papers 8
Length 25 Golden piRNA -
Aliases piR-300; PIR1299;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 4 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 3 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 183 18922463 small RNA 16.5 dpc testis
61 GSM319957 14 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 1153 18922463 small RNA 4-6 week ovary
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
132 GSM475279 29 20022248 Miwi IP adult testis
133 GSM475280 8 20022248 Mili IP adult testis
224 GSM1528806 37 26588211 small RNA 10dpp testes
225 GSM1528807 70 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 141 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 145 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 128 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 12 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 42 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 126 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
345 GSM475279 29 20022248 Miwi-IP testis 
346 GSM475280 8 20022248 Mili-IP testis 
347 GSM475281 58 20022248 small RNA testis 
441 GSM1096582 47 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 495 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 123 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 57 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 434 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 331 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 5 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 24 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 205 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 4 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:122682897-122682922:+ Gm47135 ENSMUST00000215737; Mir138-1 ENSMUST00000083480;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 31.2373
GSM261958 13.9752
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 111.0465
GSM319956 0
GSM319957 7.2153
GSM319958 1857.8855
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 2.8103
GSM433289 1.3124
GSM433290 0.6371
GSM433291 0.7115
GSM433292 10.2114
GSM433293 4.2538
GSM433294 29.5659
GSM433295 33.7728
GSM475279 2.7855
GSM475280 0.7274
GSM475281 5.4411
GSM678422 0.1061
The Expression of piRNA: piR-mmu-3321
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.