Loading...
| piRBase Id | piR-mmu-3321 | Accession | DQ540188 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | AGCTGGTGTTGTGAATCAGGCCGTT | Number of papers | 8 |
| Length | 25 | Golden piRNA | - |
| Aliases | piR-300; PIR1299; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 50 | GSM610965 | 4 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
| 51 | GSM610966 | 3 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 3 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 59 | GSM319955 | 183 | 18922463 | small RNA | 16.5 dpc testis |
| 61 | GSM319957 | 14 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 62 | GSM319958 | 1153 | 18922463 | small RNA | 4-6 week ovary |
| 86 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
| 132 | GSM475279 | 29 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 8 | 20022248 | Mili IP | adult testis |
| 224 | GSM1528806 | 37 | 26588211 | small RNA | 10dpp testes |
| 225 | GSM1528807 | 70 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 141 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 145 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 128 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 12 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 6 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 3 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 2 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 238 | GSM433292 | 42 | 26115953 | small RNA | 6 weeks hetero tdrd6 KO testes |
| 240 | GSM433294 | 126 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 345 | GSM475279 | 29 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 8 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 58 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 47 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 442 | GSM1096599 | 495 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 123 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 57 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 434 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 331 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 5 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 24 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 205 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 4 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 9:122682897-122682922:+ | Gm47135 ENSMUST00000215737; Mir138-1 ENSMUST00000083480; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 31.2373 |
| GSM261958 | 13.9752 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 111.0465 |
| GSM319956 | 0 |
| GSM319957 | 7.2153 |
| GSM319958 | 1857.8855 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 2.8103 |
| GSM433289 | 1.3124 |
| GSM433290 | 0.6371 |
| GSM433291 | 0.7115 |
| GSM433292 | 10.2114 |
| GSM433293 | 4.2538 |
| GSM433294 | 29.5659 |
| GSM433295 | 33.7728 |
| GSM475279 | 2.7855 |
| GSM475280 | 0.7274 |
| GSM475281 | 5.4411 |
| GSM678422 | 0.1061 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||