Loading...

Detail Information of piRNA: piR-mmu-3192

General Information
piRBase Id piR-mmu-3192 Accession DQ685442
Organism Mouse Number of methods 5
Sequence TGGAACTTGAAAGTTGAATTCAGAAGCTGC Number of papers 14
Length 30 Golden piRNA Y
Aliases piR-19872; piR-100764; PIR12871; PIR194090;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 11 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 8422 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 5204 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 8382 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 7661 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1792 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 3532 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2188 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 460 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 100 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 12 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 35 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 53 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 163 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 75 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 4 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 2 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 2 20439430 small RNA Mili-/- E16.5 testis
121 GSM545783 21 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 654 20022248 Miwi IP adult testis
133 GSM475280 82 20022248 Mili IP adult testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 17 25582079 MIWI CLIP round spermatids
225 GSM1528807 632 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1559 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1200 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1413 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 11 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 37 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 62 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 19 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 654 20022248 Miwi-IP testis 
346 GSM475280 82 20022248 Mili-IP testis 
347 GSM475281 549 20022248 small RNA testis 
441 GSM1096582 143 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 183 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 685 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 243 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1635 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 291 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 1627 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 320 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1634 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 928 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3513 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:66211600-66211630:+ LINE L1 L1M3;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 2.4853
Sample CPM
GSM400968 0
GSM400969 1.0032
GSM433288 2.5761
GSM433289 8.0934
GSM433290 13.1672
GSM433291 6.7588
GSM433292 18.7209
GSM433293 11.9107
GSM433294 0
GSM433295 0
GSM475279 62.8183
GSM475280 7.4555
GSM475281 51.5032
GSM678422 0.6367
The Expression of piRNA: piR-mmu-3192
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Arhgap19 NM_027667 deadenylation mm9 chr19:41843076-41843095:- n 24787618
Lpgat1 NM_001134829 deadenylation mm9 chr1:193606157-193606176:+ n 24787618
Clip4 NM_030179 deadenylation mm9 chr17:72206691-72206710:+ n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.